Graphics, Figures & Tables ⇒ Make Tables fit Page Width

[Ara]

Hi,

I'm having trouble adjusting my tables. They are too wide. I'd like them all to be one width so that it looks uniform and so that the horizontal bars are as wide as the text margins.

I know that LaTeX can make line breaks if I adjust the column width, but I couldn't have uniform tables that way.

Any suggestions?

[Ara]

Oh, and also - I have long sequences of letters within the table (oligonucleotides), which latex doesn't want to hyphenate - but if I define hyphens myself, then again, things become pretty chaotic and ugly.

And finally, the text within my table isn't justified. Is that by design, or am I doing something wrong here? Here's the code...

Code: Select all

\begin{table}[H]
\caption{employed oligonucleotides\label{tab:oligonucleotides} }
\medskip{}
\hfill{}%
\begin{tabular}{llll}
\toprule 
 number & name & sequence & underlined restriction site enzyme\tabularnewline
\midrule
TM0207  & P$_{spac}$-fwd & CCAT\textbf{\emph{\uline{CAATTG}}}\textbf{\emph{CTACATCCAGAACAACCTCTGC}}\emph{ } & MfeI\tabularnewline
TM1578  & pDG148 check-rev & TTTTCGGAAGGAAATGATGAC & -/-\tabularnewline
 TM1076  & \emph{ecf}41$_{\mathrm{\mathrm{Bli}}}$-rev & AGTC\uline{GTCGAC}TTATATTTTAATGTGCTTCAGTTTATC  & SalI\tabularnewline
 TM1904  & \emph{ecf}41$_{\mathrm{\mathrm{Bli}}}$-fwd, 3 $\times$ nFLAG & AGTC\uline{TCTAGA}\textbf{\emph{\uline{ATG}}}\textbf{\emph{GATTATAAGGATCATGATGGTGATTATAAGGATCATGATATCGACTACAAAGACGATGACGACAAGGAATATTATCGACAATATC}}\emph{ } & XbaI\tabularnewline
 TM1299  & pHCMC04 check-fwd & AACTCAATTAAGATAGTTGATGG  & -/-\tabularnewline
 TM1300  & pHCMC04 check-rev & AGTTGCAGACAAAGATCTCC  & -/-\tabularnewline
 TM2268  & \emph{ecf}41$_{\mathrm{\mathrm{Bli}}}$-rev & AGTC\uline{GCATGC}TTATATTTTAATGTGCTTCAGTTTATC  & SphI\tabularnewline
\end{tabular}\hfill{} 
\end{table}