I'm using
to create tables oriented landscape with the command\userpackage{rotating}
.\begin{sidewaystable}[h]
For some reason, the table generated this way is put after all the text in my document, and the tables and figures after that are put in the end of my document; even after the bibliography.
How can I cange that? I whant the sidewaystable to be in a in the next page, landscape oriented, with the rest of my document after that, including the text, figures and other tables, in it's right place.
Here is the MWE. I'm sory cause it is not so minimal, but my problem only shows up with a big document.
Code: Select all
\documentclass[12pt, titlepage, onecolumn, a4paper, oneside]{article}
\usepackage[english, portuguese]{babel}
\usepackage{indentfirst}
\usepackage[left=30mm,right=30mm,top=30mm,bottom=25mm,dvips]{geometry}
\usepackage[small,bf,it]{caption}
\usepackage[dvips]{graphicx}
\usepackage[usenames,dvipsnames]{color}
\usepackage{amsfonts}
\usepackage{setspace}
\usepackage[latin1]{inputenc}
\usepackage{ae,aecompl}
\usepackage{fixltx2e}
\usepackage{hhline}
\usepackage{colortbl}
\usepackage{booktabs}
\usepackage{sidecap}
\usepackage{wrapfig}
\usepackage[colorlinks=true, breaklinks]{hyperref}
\usepackage{breakurl}
\usepackage[final]{pdfpages}
\hypersetup{pdfauthor={}, pdftitle={mwe.pfd}, colorlinks=false}
%-----------------------------------------
\usepackage{natbib}
\bibpunct{(}{)}{;}{a}{,}{,}
\usepackage{tocbibind}
%-------------------------------------------------------
\usepackage{rotating}
\usepackage{blindtext}
\setlength{\headheight}{12pt}
\begin{document}
\doublespacing
\section{Rrrrrrrrrr}
\subsection{Bbbbbbbbbb bbbbbbb bbb bbbbbbbbbbbbb}
\par \blindtext
\begin{figure}[htb]
\centering
\includegraphics[width=10cm]{imagens/prop-microssat.png}
\caption[Proporção dos microsatélites encontrados, classificados pelo tamanho da unidade de repetição]{Proporção dos microsatélites encontrados, classificados pelo tamanho da unidade de repetição.}
\label{fig-prop-microssat}
\end{figure}
\par \blindtext
\begin{table}[htb]
\centering
\caption[Valores de F\textsubscript{ST} par a par: Dados de microsatélites]{Valores de FST par a par das populações estudadas, dados de microsatélites. Entre parênteses estão os valores corrigidos para alelos nulos. }
\resizebox{13cm}{!}
{
\normalsize
\begin{tabular}[htbp]{ c || c | c | c | c }
\toprule
& {\textbf{Japi1}} & {\textbf{Japi2}} & {\textbf{RC}} & {\textbf{ANT}} \\
\cmidrule{1-5}
JAPI2 & 0,112 (0,106) & & & \\
RC & 0,182 (0,175) & 0,115 (0,081) & & \\
ANT & 0,438 (0,429) & 0,303 (0,287) & 0,222 (0,204) & \\
VAL & 0,512 (0,507) & 0,423 (0,406) & 0,341 (0,304) & 0,166 (0,142) \\
\bottomrule
\multicolumn{5}{l }{} \\
\bottomrule
\end{tabular}
}\label{tab-fst-ssr}
\end{table}
\begin{figure}[htb]
\centering
\includegraphics[width=10cm]{imagens/prop-microssat.png}
\caption{Proporção dos microsatélites encontrados, classificados pela composição.}
\label{fig-prop-microssat2}
\end{figure}
\begin{sidewaystable}[h]
\centering
\caption[Primers desenhados para amplificação de marcadores de microsatélites de A. lagotis]{Primers desenhados para amplificação de marcadores de microsatélites de Aglaoctenus lagotis. Tm (ºC), temperatura de dissociação; D sequência direta ; R, sequência reversa; produto, tamanho dos produtos de PCR em pares de base; \% GC, porcentagem de CG dos primers; classificação, classificação dos microsatetélites de acordo com sua composição.}
\resizebox{23cm}{!}
%\scalebox{0.5}
{
\Large
\begin{tabular}[htb]{ c || c | c | c | c | c | c | c }
\toprule
{\textbf{Loco}} & {\textbf{Motivo de repetição}} & {\textbf{TmºC}} & \multicolumn{2}{c |}{\textbf{Sequência dos primers (5'-3')}} & {\textbf{Produto}} & {\textbf{\% GC}} & {\textbf{Classificação}} \\
\cmidrule{1-8}
A.lagotisMicrosat1 & (CA)14(TA)6 & 54 & D:CTTTCGAATTGCCTACCTT & R: TTGATGTCTACGATGTTGGA & 209 & 41.0 & Composto \\
A.lagotismicrosat2 & (TA)4(TG)17 & 55 & D:TTACGATGGATTACCGTGA & R:CCCACCATCTAGCAATGTA & 244 & 44.7 & Composto \\
A.lagotismicrosat3 & (TC)14(CA)13 & 55 & D:AACTTGCGCTAAAGGAAAC & R:GATGTGGGAGTGGATGAGT & 176 & 47.4 & Composto \\
A.lagotismicrosat4 & (TA)5(GA)5GG (GA)7(GT)16 & 55 & D:AACTAAGTCGTTCGGTTGG & R:CGCCGAAGATGAAATAAA & 169 & 43.1 & Interrompido/ Composto \\
A.lagotismicrosat5 & (TC)18(AC)7 & 55 & D:TTTATCTGGGTCGTGCTTT & R:AAGATGCCTAGGAAGGTCA & 182 & 44.7 & Composto \\
\bottomrule
\multicolumn{8}{l }{} \\
\bottomrule
\end{tabular}
}\label{tab-primers}
\end{sidewaystable}
\par \blindtext
\par \blindtext
\begin{table}[htbp]
\centering
\caption[Caracterização de oito locos de microsatélites desenvolvidos para A. lagotis]{Caracterização de oito locos de microsatélites desenvolvidos para Aglaoctenus lagotis. A, número de alelos observados; TA (ºC), temperatura de anelamento; MgCl2, concentração de MgCl2 em mM; Amplitude, amplitude do tamanho dos produtos de PCR em pares de base; HO, heterozigozidade observadada; HE, heterozigozidade esperada; GB no, o número de acesso do GenBank. }
\resizebox{15cm}{!}
%\scalebox{0.5}
{
\Large
\begin{tabular}[htb]{ c || c | c | c | c | c | c | c | c }
\toprule
{\textbf{Loco}} & {\textbf{Primer}} & {\textbf{A}} & {\textbf{TA (ºC)}} & {\textbf{MgCl2 (mM)}} & {\textbf{Amplitude (bp)}} & {\textbf{HO}} & {\textbf{HE}} & {\textbf{GB nº}} \\
\cmidrule{1-9}
Ala1 & A.lagotismicrosat7 & 7 & 56 & 01/08/11 & 245-280 & 0,6 & 0,687 & JF436856 \\
Ala2 & A.lagotismicrosat8 & 6 & 61 & 02/05/11 & 212-238 & 0,219 & 0,512 & JF436857 \\
Ala3 & A.lagotismicrosat12 & 9 & 50 & 01/03/00 & 215-300 & 0,308 & 0,382 & JF436858 \\
Ala4 & A.lagotismicrosat5 & 10 & 50 & 01/03/00 & 175-248 & 0,563 & 0,621 & JF436858 \\
\bottomrule
\multicolumn{9}{l }{} \\
\bottomrule
\end{tabular}
}\label{tab-locos}
\end{table}
\subsection{Aaaaa aa aaa aaa aa}
\par \blindtext \cite{Gilpin1986}
\begin{figure}[htb]
\centering
\includegraphics[width=10cm]{imagens/prop-microssat.png}
\caption{Número de alelos observados por loco e por população.}
\label{fig-alelos-locus-pop}
\end{figure}
\par \blindtext
\begin{figure}[htb]
\centering
\includegraphics[width=10cm]{imagens/local-grupos.jpg}
\caption[Localização dos indivíduos atribuídos aos Grupos A e B]{Mapa indicando a localização dos indivíduos atribuídos ao Grupo A (verde) e ao Grupo B (vermelho). As localidades com as cores mistas possuem indivíduos atribuído aos dois grupos. Os números correspondem à localização geográfica: 1) Japi 1; 2) Japi 2; 3) Ribeirão Cachoeira; 4) Santo Antônio das Mangueiras; 5) Valinhos.}
\label{fig-local-grupos}
\end{figure}
\par
\newpage
\onehalfspacing
\footnotesize
\bibliographystyle{chicago}
\bibliography{biblidoc-mwe}
\onehalfspacing
\end{document}
Code: Select all
@article{Avise1987,
author = {John C. Avise and Jonathan Arnold and R. Martin Ball and Eldredge Bermingham and Trip Lamb and Joseph E. Neigel and Carol A. Reeb and Nancy C. Saunders},
title = {INTRASPECIFIC PHYLOGEOGRAPHY: The Mitochondrial DNA Bridge Between Population Genetics and Systematics},
journal = {Annual Review of Ecology and Systematics},
year = {1987},
volume = {18},
number = {},
pages = {489-522},
address = {},
}
@book{Frankham2002,
author = {Richard Frankham and David Anthony Briscoe and Jonathan D. Ballou},
title = {Introduction to conservation genetics},
year = {2002},
edition = {2nd},
publisher = {Cambridge University Press},
address = {},
}
@inbook{Gilpin1986,
author = {Gilpin, M.E. and M.E. Soulé.},
title = {Minimum viable populations: processes of extinction},
editor = {M.E. SOULÉ},
booktitle = {Conservation biology: the science of scarcity and diversity},
year = {1986},
edition = {},
publisher = {Sinauer Associates},
pages ={19-34},
address = {Sunderland},
}
@article{Johannesen2007,
author = {Johannesen, J and Lubin, Y and Smith, D R and Bilde, T and Schneider, J M},
title = {The age ande evolution of sociality in Stegodyphus spiders: a molecular phylogenetic perspective},
journal = {{Proceedings of the Royal Society B: Biological Sciences}},
year = {2007},
volume = {274},
number = {},
pages = {231-237},
address = {},
}
@article{Lande1996,
author = {Russell Lande and Susan Shannon},
title = {The Role of Genetic Variation in Adaptation and Population Persistence in a Changing Environment},
journal = {evolution},
year = {1996},
volume = {50},
number = {1},
pages = {434-437},
address = {},
}
@article{Reed2003,
author = {David H. Reed and Richard Frankham},
title = {Correlation between Fitness and Genetic Diversity},
journal = {Conservation Biology},
year = {2003},
volume = {17},
number = {1},
pages = {230-237},
address = {},
}
@article{Saccheri1998,
author = {Saccheri, I and Kuussaari, M and Kankare, M and Vikman, P and Fortelius, W and Hanski, I},
title = {Inbreeding and extinction in a butterfly metapopulation},
journal = {Nature},
year = {1998},
volume = {392},
number = {},
pages = {491-494},
address = {},
}
@article{Spielman2004,
author = {Derek Spielman and Barry W. Brook and Richard Frankham},
title = {Most species are not driven to extinction before genetic factors impact them},
journal = {{PNAS} - Proceedings of the National Academy of Sciences},
year = {2004},
volume = {101},
number = {42},
pages = {15261-15264},
address = {},
}
@article{Young1996,
author = {Andrew Young and Tim Boyle and Tony Brown},
title = {The population genetic consequences of habitat fragmentation for plants},
journal = {Trends in Ecology \& Evolution},
year = {1996},
volume = {11},
number = {10},
pages = {413-418},
address = {},
}
http://reverdejar.dominiotemporario.com ... grupos.jpg
http://reverdejar.dominiotemporario.com ... rossat.png
